mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.38.1
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 598 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | Xen14_131 | 1,401 | 0 | A | C | 79.2% | 174.7 / 91.6 | 179 | L45W (TTG→TGG) | Xen14_04738 | hypothetical protein |
| * | Xen14_143 | 915 | 0 | C | T | 79.1% | 2331.9 / inf | 1379 | intergenic (‑609/–) | Xen14_04759/– | hypothetical protein/– |
| * | Xen14_126 | 1,900 | 0 | A | T | 78.9% | 2876.4 / inf | 1461 | R38R (CGA→CGT) | Xen14_04726 | hypothetical protein |
| * | Xen14_126 | 2,062 | 0 | T | C | 78.2% | 1392.3 / inf | 855 | A92A (GCT→GCC) | Xen14_04726 | hypothetical protein |
| * | Xen14_126 | 2,063 | 0 | C | A | 77.9% | 1695.0 / inf | 857 | L93I (CTT→ATT) | Xen14_04726 | hypothetical protein |
| * | Xen14_131 | 1,429 | 0 | G | A | 77.9% | 190.7 / 66.6 | 172 | L36L (CTG→TTG) | Xen14_04738 | hypothetical protein |
| * | Xen14_131 | 1,414 | 0 | A | C | 77.6% | 181.3 / 100.5 | 179 | Y41D (TAT→GAT) | Xen14_04738 | hypothetical protein |
| * | Xen14_143 | 155 | 0 | G | A | 77.6% | 1203.4 / inf | 760 | A51V (GCG→GTG) | Xen14_04759 | hypothetical protein |
| * | Xen14_126 | 2,068 | 0 | T | G | 77.5% | 1827.0 / inf | 863 | T94T (ACT→ACG) | Xen14_04726 | hypothetical protein |
| * | Xen14_126 | 2,059 | 0 | T | G | 77.4% | 1775.1 / inf | 858 | A91A (GCT→GCG) | Xen14_04726 | hypothetical protein |
| * | Xen14_28 | 132 | 0 | G | C | 77.2% | 428.4 / 132.5 | 203 | intergenic (–/‑453) | –/gadC | –/putative glutamate/gamma‑aminobutyrate antiporter |
| * | Xen14_126 | 2,066 | 0 | A | G | 77.1% | 1377.3 / inf | 862 | T94A (ACT→GCT) | Xen14_04726 | hypothetical protein |
| * | Xen14_17 | 79,627 | 0 | T | C | 76.5% | 892.9 / inf | 1005 | S215G (AGC→GGC) ‡ | Xen14_02064 | IS4 family transposase ISEc13 |
| * | Xen14_17 | 79,625 | 0 | G | A | 76.4% | 888.1 / inf | 1006 | S215S (AGC→AGT) ‡ | Xen14_02064 | IS4 family transposase ISEc13 |
| * | Xen14_17 | 79,628 | 0 | T | G | 76.1% | 854.3 / inf | 1007 | T214T (ACA→ACC) | Xen14_02064 | IS4 family transposase ISEc13 |
| * | Xen14_17 | 79,624 | 0 | T | G | 75.9% | 843.0 / inf | 1007 | S216R (AGC→CGC) | Xen14_02064 | IS4 family transposase ISEc13 |
| * | Xen14_131 | 1,376 | 0 | A | G | 75.9% | 118.3 / 69.6 | 162 | H53H (CAT→CAC) | Xen14_04738 | hypothetical protein |
| * | Xen14_126 | 1,987 | 0 | A | G | 75.4% | 1858.6 / inf | 1247 | T67T (ACA→ACG) | Xen14_04726 | hypothetical protein |
| * | Xen14_126 | 1,855 | 0 | T | G | 75.2% | 1915.4 / inf | 1378 | V23V (GTT→GTG) | Xen14_04726 | hypothetical protein |
| * | Xen14_38 | 48,337 | 0 | A | G | 75.2% | 709.4 / 283.7 | 596 | Y167H (TAC→CAC) | Xen14_03355 | IS21 family transposase IS100kyp |
| Marginal new junction evidence (lowest skew 10 of 176 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | Xen14_168 | = 298 | 2043 (1.210) | 84 (0.100) | 57/296 | 0.1 | 3.9% | coding (221/459 nt) | Xen14_04774 | IS200/IS605 family transposase IS200C |
| ? | Xen14_94 | 7510 = | NA (NA) | intergenic (‑130/–) | Xen14_04561/– | hypothetical protein/– | |||||
| * | ? | Xen14_12 | 25 = | 963 (11.610) | 61 (0.050) | 46/280 | 0.6 | 11.8% | intergenic (–/+303) | –/Xen14_01540 | –/hypothetical protein |
| ? | Xen14_166 | = 677 | 0 (0.000) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | Xen14_166 | = 330 | 1284 (0.510) | 97 (0.070) | 61/296 | 0.8 | 12.0% | intergenic (–/–) | –/– | –/– |
| ? | Xen14_38 | 48182 = | 133 (1.080) | intergenic (+768/+108) | Xen14_03354/Xen14_03355 | hypothetical protein/IS21 family transposase IS100kyp | |||||
| * | ? | Xen14_117 | = 3027 | 108 (1.210) | 4 (0.060) +CCGGAGCCGGACTCCGGTTT |
3/256 | 1.8 | 5.1% | intergenic (‑290/–) | Xen14_04703/– | hypothetical protein/– |
| ? | Xen14_194 | = 327 | 64 (0.880) | intergenic (+18/–) | Xen14_04786/– | hypothetical protein/– | |||||
| * | ? | Xen14_143 | 808 = | 1165 (1.470) | 46 (0.110) +AC |
29/292 | 1.9 | 3.8% | intergenic (‑502/–) | Xen14_04759/– | hypothetical protein/– |
| ? | Xen14_94 | = 75 | NA (NA) | intergenic (–/‑39) | –/Xen14_04554 | –/hypothetical protein | |||||
| * | ? | Xen14_138 | 1232 = | 121 (0.860) | 43 (0.030) | 32/296 | 1.9 | 2.9% | intergenic (‑5/–) | scrY_2/– | Sucrose porin/– |
| ? | Xen14_166 | 103 = | 2762 (1.110) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | Xen14_105 | = 4988 | 348 (2.040) | 80 (0.550) | 42/296 | 1.9 | 18.7% | intergenic (+229/–) | Xen14_04638/– | IS3 family transposase ISCfr6/– |
| ? | Xen14_152 | 859 = | NA (NA) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | Xen14_138 | 1231 = | 121 (0.860) | 24 (0.020) | 20/294 | 2.3 | 3.2% | intergenic (‑4/–) | scrY_2/– | Sucrose porin/– |
| ? | Xen14_166 | 327 = | 1345 (0.540) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | Xen14_138 | 1232 = | 121 (0.860) | 97 (0.250) | 48/296 | 2.4 | 16.7% | intergenic (‑5/–) | scrY_2/– | Sucrose porin/– |
| ? | Xen14_202 | 276 = | 848 (1.310) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | Xen14_202 | = 280 | 859 (1.330) | 75 (0.200) | 38/296 | 2.7 | 13.1% | intergenic (–/–) | –/– | –/– |
| ? | Xen14_38 | 48182 = | 133 (1.080) | intergenic (+768/+108) | Xen14_03354/Xen14_03355 | hypothetical protein/IS21 family transposase IS100kyp | |||||